[Home|New job]
Submission job name Example Input Data
Set temperature [°C] 37
Set local structure range [nt] 40
Region subjected to optimization 1-19
Codon(s) to be avoided CTA
Sequence motif(s) to be avoided
SD start (relative to start codon) [nt] -10
SD end (relative to start codon) [nt] -3
SD sequence GGAGATGA
Ribosome - mRNA hybridisation energy [kcal/mol] -6.90
5' UTR sequence ACTGCTTACGCGGCATTAACAATCGGCCGCCCGACAATACTGGAGATGAAT
Native sequence (to be optimized) ATGAGCTATACCCTGCCA
RBS opening energy native sequence 6.683
Translation potential δ native sequence 1.42
Optimized sequence ATGAGTTACACCCTGCCC
RBS opening energy optimized sequence 4.754
Translation potential δ optimized sequence 32.6
Accessibility plot for native and optimzed sequence.
Opening energy plot for native and optimzed sequence. Shine-Dalgarno sequence and sequence subject to optimization procedure is indicated by orange and yellow areas, respectively. Blue line indicates translation start. Dotted lines indicate positions where native and optimized sequences differ. The data point at position i indicates the energy needed to unfold a stretch of 30 nt starting from position i. The horizontal arrow indicates the relevant ribosome binding site. The vertical arrow indicates the change of opening energy for this relevant region. [PNG|PDF].
Codon usage plot for native and optimzed sequence.
Relative codon frequency in E.coli (NC_000913) for the native and optimized sequence. Useful to assess if the sequence optimized for translation initiation might suffer from impediments during elongation. If the frequency of a particular codon drops from a high to a lower level (e.g. below the bottom decile 0.092 of all codon frequencies in E. coli, as indicated by the red area) consider to repeat the optimization procedure with the additional constraint to avoid this specific codon. [PNG|PDF].

Input and optimized output sequence in fasta format:

For download:
native sequence
optimized sequence

>native construct
ACTGCTTACGCGGCATTAACAATCGGCCGCCCGACAATACTGGAGATGAA
TATGAGCTATACCCTGCCATCCCTGCCGTATGCTTACGATGCCCTGGAAC
CGCACTTCGATAAGCAGACCATGGAAATCCACCACACCAAACACCATCAG
ACCTACGTAAACAACGCCAACGCGGCGCTGGAAAGCCTGCCAGAATTTGC
CAACCTGCCGGTTGAAGAGCTGATCACCAAACTGGACCAGCTGCCAGCAG
ACAAGAAAACCGTACTGCGCAACAACGCTGGCGGTCACGCTAACCACAGC
CTGTTCTGGAAAGGTCTGAAAAAAGGCACCACCCTGCAGGGTGACCTGAA
AGCGGCTATCGAACGTGACTTCGGCTCCGTTGATAACTTCAAAGCAGAAT
TTGAAAAAGCGGCAGCTTCCCGCTTTGGTTCCGGCTGGGCATGGCTGGTG
CTGAAAGGCGATAAACTGGCGGTGGTTTCTACTGCTAACCAGGATTCTCC
GCTGATGGGTGAAGCTATTTCTGGCGCTTCCGGCTTCCCGATTATGGGCC
TGGATGTGTGGGAACATGCTTACTACCTGAAATTCCAGAACCGCCGTCCG
GACTACATTAAAGAGTTCTGGAACGTGGTGAACTGGGACGAAGCAGCGGC
ACGTTTTGCGGCGAAAAAATAA

>optimized construct
ACTGCTTACGCGGCATTAACAATCGGCCGCCCGACAATACTGGAGATGAA
TATGAGTTACACCCTGCCCTCCCTGCCGTATGCTTACGATGCCCTGGAAC
CGCACTTCGATAAGCAGACCATGGAAATCCACCACACCAAACACCATCAG
ACCTACGTAAACAACGCCAACGCGGCGCTGGAAAGCCTGCCAGAATTTGC
CAACCTGCCGGTTGAAGAGCTGATCACCAAACTGGACCAGCTGCCAGCAG
ACAAGAAAACCGTACTGCGCAACAACGCTGGCGGTCACGCTAACCACAGC
CTGTTCTGGAAAGGTCTGAAAAAAGGCACCACCCTGCAGGGTGACCTGAA
AGCGGCTATCGAACGTGACTTCGGCTCCGTTGATAACTTCAAAGCAGAAT
TTGAAAAAGCGGCAGCTTCCCGCTTTGGTTCCGGCTGGGCATGGCTGGTG
CTGAAAGGCGATAAACTGGCGGTGGTTTCTACTGCTAACCAGGATTCTCC
GCTGATGGGTGAAGCTATTTCTGGCGCTTCCGGCTTCCCGATTATGGGCC
TGGATGTGTGGGAACATGCTTACTACCTGAAATTCCAGAACCGCCGTCCG
GACTACATTAAAGAGTTCTGGAACGTGGTGAACTGGGACGAAGCAGCGGC
ACGTTTTGCGGCGAAAAAATAA