[Home|New job]
Submission job name Example Input Data
Set temperature [°C] 37
region to subjected to optization 1-19
sequence motifs to be avoided
SD start (relative to start codon) [nt] -11
SD end (relative to start codon) [nt] -3
SD sequence GGAGATGA
ribosome - mRNA hybridisation energy [Kcal/mol] -6.90
sequence 5'UTR ACTGCTTACGCGGCATTAACAATCGGCCGCCCGACAATACTGGAGATGAAT
native sequence (to be optimized) ATGAGCTATACCCTGCCA
RBS opening energy native sequence 6.982
translation potential δ native sequence 0.875351405030289
optimized sequence ATGAGTTACACCCTACCC
RBS opening energy optimized sequence 4.501
translation potential δ optimized sequence 49.149191253091
Accessibility plot for native and optimzed sequence.
Opening energy plot for native and optimzed sequence. Shine-Dalgarno sequence and sequence subject to optimization procedure is indicated by orange and yellow areas, respectively. Blue line indicates translation start. Dotted lines indicate positions where native and optimized sequences differ. The data point at position i indicates the energy needed to unfold a stretch of 30 nt starting from position i. The horizontal arrow indicated the relevant ribosome binding site. The vertical arrow indicates the change of opening energy for this relevant region. [PNG|PDF].

Input and optimized output sequence in fasta format:

For download:
native sequence
optimized sequence

>native construct
ACTGCTTACGCGGCATTAACAATCGGCCGCCCGACAATACTGGAGATGAA
TATGAGCTATACCCTGCCATCCCTGCCGTATGCTTACGATGCCCTGGAAC
CGCACTTCGATAAGCAGACCATGGAAATCCACCACACCAAACACCATCAG
ACCTACGTAAACAACGCCAACGCGGCGCTGGAAAGCCTGCCAGAATTTGC
CAACCTGCCGGTTGAAGAGCTGATCACCAAACTGGACCAGCTGCCAGCAG
ACAAGAAAACCGTACTGCGCAACAACGCTGGCGGTCACGCTAACCACAGC
CTGTTCTGGAAAGGTCTGAAAAAAGGCACCACCCTGCAGGGTGACCTGAA
AGCGGCTATCGAACGTGACTTCGGCTCCGTTGATAACTTCAAAGCAGAAT
TTGAAAAAGCGGCAGCTTCCCGCTTTGGTTCCGGCTGGGCATGGCTGGTG
CTGAAAGGCGATAAACTGGCGGTGGTTTCTACTGCTAACCAGGATTCTCC
GCTGATGGGTGAAGCTATTTCTGGCGCTTCCGGCTTCCCGATTATGGGCC
TGGATGTGTGGGAACATGCTTACTACCTGAAATTCCAGAACCGCCGTCCG
GACTACATTAAAGAGTTCTGGAACGTGGTGAACTGGGACGAAGCAGCGGC
ACGTTTTGCGGCGAAAAAATAA

>optimized construct
ACTGCTTACGCGGCATTAACAATCGGCCGCCCGACAATACTGGAGATGAA
TATGAGTTACACCCTACCCTCCCTGCCGTATGCTTACGATGCCCTGGAAC
CGCACTTCGATAAGCAGACCATGGAAATCCACCACACCAAACACCATCAG
ACCTACGTAAACAACGCCAACGCGGCGCTGGAAAGCCTGCCAGAATTTGC
CAACCTGCCGGTTGAAGAGCTGATCACCAAACTGGACCAGCTGCCAGCAG
ACAAGAAAACCGTACTGCGCAACAACGCTGGCGGTCACGCTAACCACAGC
CTGTTCTGGAAAGGTCTGAAAAAAGGCACCACCCTGCAGGGTGACCTGAA
AGCGGCTATCGAACGTGACTTCGGCTCCGTTGATAACTTCAAAGCAGAAT
TTGAAAAAGCGGCAGCTTCCCGCTTTGGTTCCGGCTGGGCATGGCTGGTG
CTGAAAGGCGATAAACTGGCGGTGGTTTCTACTGCTAACCAGGATTCTCC
GCTGATGGGTGAAGCTATTTCTGGCGCTTCCGGCTTCCCGATTATGGGCC
TGGATGTGTGGGAACATGCTTACTACCTGAAATTCCAGAACCGCCGTCCG
GACTACATTAAAGAGTTCTGGAACGTGGTGAACTGGGACGAAGCAGCGGC
ACGTTTTGCGGCGAAAAAATAA